Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070G07

Clone ID RBdS070G07
HP ID HP05024
Gene ID 537
Gene Symbol ATP6AP1
Protein Name ATPase, H+ transporting, lysosomal accessory protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001183.4
Length of RefSeq (bp) 2109
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.6551
5'-terminal sequence GAGTGGAGGCTGAGGCTATGATGGCGGCCATGGCGACGGCTCGAGTGCGGATGGGGCCGC
2011.08.28