Prev. |  KEGG KO K02152 > 

RIKEN DNA Bank Human Resource - ATP6V1G2

Gene ID NCBI Gene 534 |  KEGG hsa:534
Gene Symbol ATP6V1G2
Protein Name ATPase H+ transporting V1 subunit G2
Synonyms ATP6G|ATP6G2|NG38|VMA10
Ortholog resources KEGG ortholog (KEGG orthology K02152) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039556 IRAK098O20 pCMV-SPORT6 BC047791 NM_138282
HGX056529 IRAK141F09 pCMV-SPORT6 BC068023 NM_138282 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173602 ARi34A02 pGCAP10 NM_130463.2  
GGGGGGTGGGAGCCATCTGGTACTTTGACAGCATTCAAAACAGCATCGGCCATAACAACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv

2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl