Prev. |  Human A to Z list >  A >  ATP6V1G2 > 

ARi34A02 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR173602
Clone Name ARi34A02
Clone info. Plasmid clone of human ATP6V1G2 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGGGGGTGGGAGCCATCTGGTACTTTGACAGCATTCAAAACAGCATCGGCCATAACAACA
Sequence, submitted(2) n.a.
 
Sequence, refered NM_130463.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ATP6V1G2 (NCBI Gene 534)  other clone of ATP6V1G2 in our bank
Synonyms ATP6G|ATP6G2|NG38|VMA10
Protein Name ATPase H+ transporting V1 subunit G2
KEGG hsa:534
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR173602 ARi34A02 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.11.20

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl