Prev. |  KEGG KO K03661 > 

RIKEN DNA Bank Human Resource - ATP6V0B

Gene ID NCBI Gene 533 |  KEGG hsa:533
Gene Symbol ATP6V0B
Protein Name ATPase H+ transporting V0 subunit b
Synonyms ATP6F|HATPL|VMA16
Ortholog resources KEGG ortholog (KEGG orthology K03661) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046194 IRAK115I02 pCMV-SPORT6 BC053601 NM_004047 Partial/var
HGY080752 IRAL001O16 pOTB7 BC000423 NM_004047 Full
HGY084043 IRAL010B19 pOTB7 BC005876 NM_004047 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060830 ARe52B06 pKA1U5 NM_001039457.1  
GAGACTGCGGGACNGACGGTGGACGCTGGGACCCGTTTTGTAGCTCCGGCCCCGCCGNTT
HKR234100 ARiS085E04 pGCAP10 NM_001039457.1  
GAGACTGCGGGACGGACGGTGGACGCTGGGACGCGTTTGTAGCTCCGGCCCCGCCGTTCC
HKR247481 ARiS118L17 pGCAP10 NM_001039457.1  
GAGACTGCNGGACGGACGGTGGACGCTGGGACGCGTTTGTAGCTCCGGCCCCGCCGTTCC
HKR380904 RBd52E08 pGCAP10 NM_001039457.1  
GGGGGCGGGCGGACAGACTGCGGGACGGACGGTGGACGCTGGGACGCGTTTGTAGCTCCG
HKR433508 RBdS083M20 pGCAP10 NM_001039457.1  
GGGGACGGACGGTGGACGCTGGGACGCGTTTGTAGCTCCGGCCCCGCCGTTCCGACCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl