Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083M20

Clone ID RBdS083M20
HP ID HP00442
Gene ID 533
Gene Symbol ATP6V0B
Protein Name ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001039457.1
Length of RefSeq (bp) 979
Chromosome 1p32.3
Reference DDBJ accession
UniGene Hs.596514
5'-terminal sequence GGGGACGGACGGTGGACGCTGGGACGCGTTTGTAGCTCCGGCCCCGCCGTTCCGACCCCC
2011.08.28