Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP6V1B2

Gene ID (NCBI) 526
Gene Symbol ATP6V1B2
Protein Name ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Synonyms ATP6B1B2|ATP6B2|HO57|VATB|VPP3|Vma2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02147)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY013218 IRAK033A18 pBluescriptR BC030640 NM_001693 Full/var
HGY082622 IRAL006J06 pOTB7 BC003100 NM_001693 Full
HGY089152 IRAL022O16 pOTB7 BC007309 NM_001693 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054005 ARe35A05 pKA1U5 NM_001693.3  
GGCTGCTGGGCCAGCTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGAT
HKR062077 ARe55D05 pKA1U5 NM_001693.3  
GGGGCCAGNTCGGNCACAGAGGTAGACAAGATGGCCCCTTTNAAGCGATGCGCGGGGATT
HKR186850 ARi67C02 pGCAP10 NM_001693.3  
GGGGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAAC
HKR068028 ARe70B04 pKA1U5 NM_001693.3  
GGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAACGG
HKR234922 ARiS087F02 pGCAP10 NM_001693.3  
GGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAACGG
HKR247490 ARiS118M02 pGCAP10 NM_001693.3  
GGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAACGGGGCCGCACCCGAGCT
HKR368153 RBd20G09 pGCAP10 NM_001693.3  
GGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAACGG
HKR368804 RBd22A04 pGCAP10 NM_001693.3  
GGGGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAAC
HKR378898 RBd47E02 pGCAP10 NM_001693.3  
GGGGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAAC
HKR344009 RBb60A09 pGCAP1 NM_001693.3  
GAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAACGGGGC
HKR387702 RBd69E06 pGCAP10 NM_001693.3  
GAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAACGGGGCCGCACCCGA
HKR393332 RBd83F12 pGCAP10 NM_001693.3  
GGCTGGGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTC
HKR420769 RBdS051P09 pGCAP10 NM_001693.3  
GGGGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCAAC
HKR462638 RBdS156J22 pGCAP10 NM_001693.3  
GGTGGGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl