Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156J22

Clone ID RBdS156J22
HP ID HP01051
Gene ID 526
Gene Symbol ATP6V1B2
Protein Name ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001693.3
Length of RefSeq (bp) 3054
Chromosome 8p22-p21
Reference DDBJ accession
UniGene Hs.295917
5'-terminal sequence GGTGGGCCAGTCGGGACAGAGGAGACAAGATGGCGCTGCGGGCGATGCGGGGGATTGTCA
2011.08.28