Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5I

Gene ID (NCBI) 521
Gene Symbol ATP5I
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
Synonyms ATP5K
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02129)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086540 IRAL016F20 pDNR-LIB BC003679 NM_007100 Full
HGY086806 IRAL017A06 pOTB7 BC017215 NM_007100 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082847 M01C007B23 pDONR221 FLJ01-C12 AK000656 NM_007100  
HGE082895 M01C007D23 pDONR221 FLJ01-C12 AK000656 NM_007100  
HGE082943 M01C007F23 pDONR221 FLJ01-C12 AK000656 NM_007100  
HGE082991 M01C007H23 pDONR221 FLJ01-C12 AK000656 NM_007100  
HGE083039 M01C007J23 pDONR221 FLJ01-C12 AK000656 NM_007100  
HGE083087 M01C007L23 pDONR221 FLJ01-C12 AK000656 NM_007100  
HGE083135 M01C007N23 pDONR221 FLJ01-C12 AK000656 NM_007100  
HGE083183 M01C007P23 pDONR221 FLJ01-C12 AK000656 NM_007100  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168125 ARi20F05 pGCAP10 NM_007100.2  
GGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGCT
HKR056556 ARe41G12 pKA1U5 NM_007100.2  
GCCGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGNTGCAGGTCTCTCCGCTCATCAA
HKR182148 ARi55G04 pGCAP10 NM_007100.2  
GGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGCTCGGCCGCTACTCCGC
HKR186553 ARi66G09 pGCAP10 NM_007100.2  
TGGTCTGCAGGTTGTGCTTCCGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAG
HKR222038 ARiS055B14 pGCAP10 NM_007100.2  
GCGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGC
HKR243737 ARiS109F17 pGCAP10 NM_007100.2  
GGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGCTCGG
HKR320905 RBb02E09 pKA1U5 NM_007100.2  
GGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGNTGCAGGTCTCTCCGCTCATCAAGC
HKR322479 RBb06D07 pKA1U5 NM_007100.2  
GACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGCTCGGCCGCTACTCCGCC
HKR322501 RBb06E05 pKA1U5 NM_007100.2  
GGTGCTTCCGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGNTGCAGGTCTCTCCGCT
HKR360500 RBd01E04 pGCAP10 NM_007100.2  
GGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGCT
HKR362121 RBd05F01 pGCAP10 NM_007100.2  
GGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGCT
HKR331373 RBb28H05 pGCAP1 NM_007100.2  
GGTCTGCAGGTTTGTGCTTCCGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAG
HKR340175 RBb50H07 pGCAP1 NM_007100.2  
TGGCTTCCGGCTGCGGAGGGTCAGGGACAAGAATGGTTGCCACCGGTTGCAGGTCTCTCC
HKR341631 RBb54B07 pGCAP1 NM_007100.2  
GGTTGTGCTTCCGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGNTGCAGGTCTCTCC
HKR409151 RBdS022O15 pGCAP10 NM_007100.2  
GCTTTTGCCTCCAAGGCTTTGCTGGCTTGTGCGGCATCCTGCTCCGTCTGCAGGTTGTGC
HKR420439 RBdS051B15 pGCAP10 NM_007100.2  
GCTTTTTTTGCCTCCAAGGCTTTGCTGGCTTGTGCGGCATCCTGCTCCGTCTGCAGGTTG
HKR441929 RBdS104N17 pGCAP10 NM_007100.2  
GGCTTCCGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCAT
HKR475156 RBdS187O20 pGCAP10 NM_007100.2  
GGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl