Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187O20

Clone ID RBdS187O20
HP ID HP02454
Gene ID 521
Gene Symbol ATP5I
Protein Name ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_007100.2
Length of RefSeq (bp) 368
Chromosome 4p16.3
Reference DDBJ accession
UniGene Hs.85539
5'-terminal sequence GGGTGCGGAGGTCAGGGACAAGATGGTGCCACCGGTGCAGGTCTCTCCGCTCATCAAGCT
2011.08.28