Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5G2

Gene ID (NCBI) 517
Gene Symbol ATP5G2
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
Synonyms ATP5A
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02128)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY095041 IRAL037K01 pDNR-LIB BC020826 NM_005176 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082010 ARf05A10 pKA1U5 NM_005176.5  
TGCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTCG
HKR170854 ARi27C06 pGCAP10 NM_005176.5  
GCTCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGA
HKR055302 ARe38E06 pKA1U5 NM_005176.5  
GTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAA
HKR174097 ARi35E01 pGCAP10 NM_005176.5  
GCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGA
HKR174926 ARi37F06 pGCAP10 NM_005176.5  
GGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTC
HKR057279 ARe43D07 pKA1U5 NM_005176.5  
GCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTCGCCTG
HKR057658 ARe44C10 pKA1U5 NM_005176.5  
GGCTCCGCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCAC
HKR058449 ARe46C01 pKA1U5 NM_005176.5  
GCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGA
HKR176826 ARi42B02 pGCAP10 NM_005176.5  
GGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTC
HKR069283 ARe73D11 pKA1U5 NM_005176.5  
TTGGGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTCGCCTGC
HKR205307 ARiS013E11 pGCAP10 NM_005176.5  
GGCTGCTCCGCCCCNNNCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCT
HKR234860 ARiS087C12 pGCAP10 NM_005176.5  
GCCCCGCTGCTCCGCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGC
HKR235406 ARiS088I14 pGCAP10 NM_005176.5  
TTGGCCTTCCTTTCGCTCTTCCCGCTGCTCCGCCCCTCTCTGTCTTCTCTGCAGTGGGAG
HKR321297 RBb03E01 pKA1U5 NM_005176.5  
GCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGT
HKR366406 RBd16A06 pGCAP10 NM_005176.5  
GCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTG
HKR368076 RBd20D04 pGCAP10 NM_005176.5  
GCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTG
HKR368929 RBd22F09 pGCAP10 NM_005176.5  
HKR369603 RBd24A03 pGCAP10 NM_005176.5  
GCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAAT
HKR372145 RBd30G01 pGCAP10 NM_005176.5  
GGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTC
HKR374148 RBd35G04 pGCAP10 NM_005176.5  
GCCCCGCTGCTCCGCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGC
HKR344808 RBb62A08 pGCAP1 NM_005176.5  
GCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTCGC
HKR384898 RBd62E02 pGCAP10 NM_005176.5  
GCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAA
HKR390177 RBd75H09 pGCAP10 NM_005176.5  
GTCCGCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCC
HKR394972 RBd87H04 pGCAP10 NM_005176.5  
GGCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCT
HKR430308 RBdS075M20 pGCAP10 NM_005176.5  
GCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAAT
HKR444079 RBdS110D07 pGCAP10 NM_005176.5  
CTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAA
HKR452827 RBdS132B03 pGCAP10 NM_005176.5  
GGCTCTTCCCGCTGCTCCGCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCC
HKR461667 RBdS154C19 pGCAP10 NM_005176.5  
GCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGA
HKR471159 RBdS177O23 pGCAP10 NM_005176.5  
GGCCATAAAAATGCAGATGGAGGATCGGTGTGAAATAACGGGCCCATATAAATCCCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl