Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132B03

Clone ID RBdS132B03
HP ID HP00306
Gene ID 517
Gene Symbol ATP5G2
Protein Name ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005176.5
Length of RefSeq (bp) 898
Chromosome 12q13.13
Reference DDBJ accession
UniGene Hs.524464
5'-terminal sequence GGCTCTTCCCGCTGCTCCGCCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCC
2011.08.28