Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5G1

Gene ID (NCBI) 516
Gene Symbol ATP5G1
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Synonyms ATP5A|ATP5G
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02128)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083233 IRAL008B09 pOTB7 BC004963 NM_005175 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097619 M01C044A19 pDONR221 MGC11-E10 BC004963 XM_938765  
HGE097667 M01C044C19 pDONR221 MGC11-E10 BC004963 XM_938765  
HGE097715 M01C044E19 pDONR221 MGC11-E10 BC004963 XM_938765  
HGE097763 M01C044G19 pDONR221 MGC11-E10 BC004963 XM_938765  
HGE097811 M01C044I19 pDONR221 MGC11-E10 BC004963 XM_938765  
HGE097859 M01C044K19 pDONR221 MGC11-E10 BC004963 XM_938765  
HGE097907 M01C044M19 pDONR221 MGC11-E10 BC004963 XM_938765  
HGE097955 M01C044O19 pDONR221 MGC11-E10 BC004963 XM_938765  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060484 ARe51D12 pKA1U5 NM_005175.2  
GACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAGACCGCCGGGGCATTATTCATTTC
HKR329300 RBb23E04 pGCAP1 NM_005175.2  
GAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAGACCGCCGGGGCATTATTCATT
HKR332970 RBb32H02 pGCAP1 NM_005175.2  
GGAAGCTGAGGGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAGACCGCCG
HKR340926 RBb52F06 pGCAP1 NM_005175.2  
GGGGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAGACC
HKR344980 RBb62H12 pGCAP1 NM_005175.2  
GGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAGACCGCCGGGGCATTATTCAT
HKR399279 RBd98D07 pGCAP10 NM_005175.2  
GGTCACCTTGAGCCGGGCGAGCGCTGTGGGCCAAGCAGGGGTTGCAGGGTAGTAGGAGTG
HKR406247 RBdS015K07 pGCAP10 NM_005175.2  
GGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAGACCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl