Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015K07

Clone ID RBdS015K07
HP ID HP01430
Gene ID 516
Gene Symbol ATP5G1
Protein Name ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005175.2
Length of RefSeq (bp) 663
Chromosome 17q21.32
Reference DDBJ accession
UniGene Hs.80986
5'-terminal sequence GGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAGACCGC
2011.08.28