Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5E

Gene ID (NCBI) 514
Gene Symbol ATP5E
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Synonyms ATPE|MC5DN3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02135)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081533 IRAL003N21 pOTB7 BC001690 NM_006886 Full
HGY086538 IRAL016F18 pDNR-LIB BC003671 NM_006886 Full
HGY103124 IRAL057N12 pDNR-LIB BC070167 NM_006886

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082808 M01C007A08 pDONR221 FLJ01-B04 AK026556 NM_006886  
HGE082856 M01C007C08 pDONR221 FLJ01-B04 AK026556 NM_006886  
HGE082904 M01C007E08 pDONR221 FLJ01-B04 AK026556 NM_006886  
HGE082952 M01C007G08 pDONR221 FLJ01-B04 AK026556 NM_006886  
HGE083000 M01C007I08 pDONR221 FLJ01-B04 AK026556 NM_006886  
HGE083048 M01C007K08 pDONR221 FLJ01-B04 AK026556 NM_006886  
HGE083096 M01C007M08 pDONR221 FLJ01-B04 AK026556 NM_006886  
HGE083144 M01C007O08 pDONR221 FLJ01-B04 AK026556 NM_006886  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081770 ARf04H02 pKA1U5 NM_006886.2  
GGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGC
HKR044078 ARe10D06 pKA1U5 NM_006886.2  
AGCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCG
HKR048129 ARe20F09 pKA1U5 NM_006886.2  
GGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGCAT
HKR168570 ARi21H02 pGCAP10 NM_006886.2  
GGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGC
HKR170506 ARi26E10 pGCAP10 NM_006886.2  
GGCTTCTGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCG
HKR052460 ARe31C12 pKA1U5 NM_006886.2  
GGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGC
HKR172127 ARi30F07 pGCAP10 NM_006886.2  
GGCTTCTGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCG
HKR174499 ARi36E03 pGCAP10 NM_006886.2  
GGCTTCTGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCG
HKR058508 ARe46E12 pKA1U5 NM_006886.2  
TGATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGCATGGTGG
HKR181257 ARi53C09 pGCAP10 NM_006886.2  
GGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGCATGGTGGCCTACTGGAG
HKR067234 ARe68B10 pKA1U5 NM_006886.2  
GGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCG
HKR184145 ARi60G01 pGCAP10 NM_006886.2  
GGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGA
HKR077225 ARe93B01 pKA1U5 NM_006886.2  
GGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGATCTTGGCGATTCGGCCCGACG
HKR249113 ARiS122N01 pGCAP10 NM_006886.2  
GCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCC
HKR260098 ARiS150E02 pGCAP10 NM_006886.2  
GGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGC
HKR326074 RBb15D02 pKA1U5 NM_006886.2  
GCTCTTCCGCTTCTGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATT
HKR326952 RBb17G08 pKA1U5 NM_006886.2  
GCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCC
HKR330947 RBb27G03 pGCAP1 NM_006886.2  
GCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCC
HKR368429 RBd21B05 pGCAP10 NM_006886.2  
HKR370804 RBd27A04 pGCAP10 NM_006886.2  
GTCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGC
HKR371346 RBd28G02 pGCAP10 NM_006886.2  
TGGCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCG
HKR334571 RBb36H03 pGCAP1 NM_006886.2  
GGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGG
HKR335606 RBb39A06 pGCAP1 NM_006886.2  
GCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCC
HKR372949 RBd32G05 pGCAP10 NM_006886.2  
GGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGCATGGTGGCCTACTGGAG
HKR336484 RBb41D12 pGCAP1 NM_006886.2  
GGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGC
HKR341279 RBb53D07 pGCAP1 NM_006886.2  
AAATGTGGCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGNCGGCGTCTTGGCGATTC
HKR382153 RBd55G09 pGCAP10 NM_006886.2  
GGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGNATGGTGGCCTACTG
HKR346054 RBb65C06 pGCAP1 NM_006886.2  
GGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGG
HKR387300 RBd68E04 pGCAP10 NM_006886.2  
GATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGCATGGTGGC
HKR388955 RBd72G11 pGCAP10 NM_006886.2  
GGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCG
HKR390033 RBd75B09 pGCAP10 NM_006886.2  
GGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCG
HKR394932 RBd87F12 pGCAP10 NM_006886.2  
GCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGAC
HKR406192 RBdS015H24 pGCAP10 NM_006886.2  
GGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGCATGGT
HKR420420 RBdS051A20 pGCAP10 NM_006886.2  
GGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGC
HKR428063 RBdS070C15 pGCAP10 NM_006886.2  
GCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGAC
HKR433369 RBdS083H01 pGCAP10 NM_006886.2  
GATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGCATGGTGGC
HKR441937 RBdS104O01 pGCAP10 NM_006886.2  
GGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGC
HKR461759 RBdS154G15 pGCAP10 NM_006886.2  
GTTCCGCTTCTGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCC
HKR470830 RBdS177B06 pGCAP10 NM_006886.2  
GGCTTCTGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACATTGCCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl