Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051A20

Clone ID RBdS051A20
HP ID HP00679
Gene ID 514
Gene Symbol ATP5E
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006886.2
Length of RefSeq (bp) 417
Chromosome 20q13.32
Reference DDBJ accession
UniGene Hs.177530
5'-terminal sequence GGAGCCGACATTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGC
2011.08.28