Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5A1

Gene ID (NCBI) 498
Gene Symbol ATP5A1
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Synonyms ATP5A|ATP5AL2|ATPM|HEL-S-123m|MC5DN4|MOM2|OMR|ORM|hATP1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02132)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005348 IRAK013G04 pCMV-SPORT6 BC011384 NM_004046 Full/var
HGX005507 IRAK013M19 pCMV-SPORT6 BC039135 NM_004046 Full/var
HGX044078 IRAK110D06 pCMV-SPORT6 BC067385 NM_004046 Full
HGX055675 IRAK139D03 pCMV-SPORT6 BC064562 NM_004046 Full
HGY082554 IRAL006G10 pOTB7 BC003119 NM_004046 Partial
HGY083762 IRAL009G18 pOTB7 BC019310 NM_004046 Full
HGY089137 IRAL022O01 pOTB7 BC007299 NM_004046 Partial
HGY089548 IRAL023O12 pOTB7 BC008028 NM_004046 Partial
HGY091909 IRAL029M21 pOTB7 BC016046 NM_004046 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR179682 ARi49D10 pGCAP10 NM_004046.4  
GGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGC
HKR203381 ARiS008H13 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR320506 RBb01E10 pKA1U5 NM_004046.4  
GTGGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCT
HKR321258 RBb03C10 pKA1U5 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR321677 RBb04D05 pKA1U5 NM_004046.4  
GGTCCCAGNTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAA
HKR322149 RBb05G05 pKA1U5 NM_004046.4  
GGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGC
HKR322474 RBb06D02 pKA1U5 NM_004046.4  
ATCCTGGAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR323250 RBb08C02 pKA1U5 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR323283 RBb08D11 pKA1U5 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR323345 RBb08G01 pKA1U5 NM_004046.4  
TGTTTTGTCCCAGTCAGTCCGGAGGCTGCGGCNGCNGAAGTACCGCCTGCGGAGTAACTG
HKR323702 RBb09E06 pKA1U5 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR323722 RBb09F02 pKA1U5 NM_004046.4  
CCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGC
HKR360803 RBd02A03 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR360950 RBd02G06 pGCAP10 NM_004046.4  
G.CCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGA
HKR362131 RBd05F11 pGCAP10 NM_004046.4  
GACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCNGTCCGGAGGCTGCGGCTCTTGAAG
HKR362456 RBd06C08 pGCAP10 NM_004046.4  
GGTCTTGACCTTCTTTGCGGGTCGGCCATTTTGACCCAACTGTTCCGGAGGCTGCGGCTG
HKR362576 RBd06H08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR362857 RBd07C09 pGCAP10 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR362954 RBd07G10 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR363250 RBd08C02 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR363256 RBd08C08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR363307 RBd08E11 pGCAP10 NM_004046.4  
GATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTG
HKR363629 RBd09B05 pGCAP10 NM_004046.4  
GGTCACTCCGGACGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCCAAGATGCTG
HKR363731 RBd09F11 pGCAP10 NM_004046.4  
GCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGC
HKR363779 RBd09H11 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR324055 RBb10C07 pKA1U5 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR324527 RBb11F07 pKA1U5 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR325376 RBb13H08 pKA1U5 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR325609 RBb14A09 pKA1U5 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR325722 RBb14F02 pKA1U5 NM_004046.4  
GCCCAGATCAGTCCGGTAGGCTGCGGCTTGCAGAAGCTACCGCCTGCGGAGTAACTGCAA
HKR326555 RBb16G11 pKA1U5 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR326945 RBb17G01 pKA1U5 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR327203 RBb18A03 pKA1U5 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR327303 RBb18E07 pKA1U5 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR327304 RBb18E08 pKA1U5 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR327634 RBb19B10 pKA1U5 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR364056 RBd10C08 pGCAP10 NM_004046.4  
CGGCCGGCCGATATTTTGTGGCACCCCGGCCGGAGGTCTCCCTTGAGTGAGGGTTACTTG
HKR364409 RBd11A09 pGCAP10 NM_004046.4  
GCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR364498 RBd11E02 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR365704 RBd14E08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR365749 RBd14G05 pGCAP10 NM_004046.4  
HKR365754 RBd14G10 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGATGCACAAATACCGCCTGCGGAGTANTGCAAANATGCTGTCCN
HKR366051 RBd15C03 pGCAP10 NM_004046.4  
GATCTTCCCCGGAGCCTGCGGCTGCAGAAGTACCGCCTGCGGAGNGACTGTTAAGATGTT
HKR366970 RBd17H02 pGCAP10 NM_004046.4  
GCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTC
HKR367204 RBd18A04 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR367274 RBd18D02 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR367609 RBd19A09 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR367756 RBd19G12 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR328077 RBb20D05 pKA1U5 NM_004046.4  
TGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGC
HKR328103 RBb20E07 pKA1U5 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR329630 RBb24B06 pGCAP1 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR330008 RBb25A08 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR330480 RBb26D08 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR331633 RBb29B09 pGCAP1 NM_004046.4  
GGTCCCAGNTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAA
HKR331660 RBb29C12 pGCAP1 NM_004046.4  
GCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR368080 RBd20D08 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR368097 RBd20E01 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR368526 RBd21F06 pGCAP10 NM_004046.4  
AGTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGC
HKR368551 RBd21G07 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR368853 RBd22C05 pGCAP10 NM_004046.4  
GCATTTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAAC
HKR369297 RBd23E01 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR369655 RBd24C07 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR370059 RBd25C11 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR370081 RBd25D09 pGCAP10 NM_004046.4  
GGTCTTGACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTG
HKR370084 RBd25D12 pGCAP10 NM_004046.4  
GAGTCCTCCCGCCAGGCTTCGGCTGCAAACAACCGCCTGCGNGGTACCGGCAAACATGCN
HKR370129 RBd25F09 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR370454 RBd26C06 pGCAP10 NM_004046.4  
GGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTG
HKR370806 RBd27A06 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR370827 RBd27B03 pGCAP10 NM_004046.4  
GGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGTGGTCCGCGCCCTT
HKR370882 RBd27D10 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR371606 RBd29A06 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR332057 RBb30C09 pGCAP1 NM_004046.4  
GGACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAA
HKR332806 RBb32A06 pGCAP1 NM_004046.4  
GGTCCCAGCTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTTGCGGAGTAACTGCAA
HKR332811 RBb32A11 pGCAP1 NM_004046.4  
HKR332971 RBb32H03 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR333230 RBb33B06 pGCAP1 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR335321 RBb38F01 pGCAP1 NM_004046.4  
GCCCAGTCAGTCCGGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGA
HKR335605 RBb39A05 pGCAP1 NM_004046.4  
GCCCAGNTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGA
HKR335608 RBb39A08 pGCAP1 NM_004046.4  
GCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTC
HKR335657 RBb39C09 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR335749 RBb39G05 pGCAP1 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR372128 RBd30F08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR372477 RBd31D05 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR372521 RBd31F01 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR373231 RBd33B07 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR373322 RBd33F02 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR373608 RBd34A08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR374105 RBd35E09 pGCAP10 NM_004046.4  
GATTGCAAGCCTCGCTTCGTTGCCACTTCCCAGCTCTTCCCGCCTTCCGCGGTATAATCA
HKR374481 RBd36D09 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR374550 RBd36G06 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR374809 RBd37A09 pGCAP10 NM_004046.4  
GCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR374831 RBd37B07 pGCAP10 NM_004046.4  
CGGCCGGCCGATGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAAC
HKR374835 RBd37B11 pGCAP10 NM_004046.4  
CGGCCGGCCGATGAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGT
HKR375258 RBd38C10 pGCAP10 NM_004046.4  
CGGCCGGCCGATGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAAC
HKR375323 RBd38F03 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR336499 RBb41E03 pGCAP1 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR337380 RBb43H12 pGCAP1 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR338011 RBb45A11 pGCAP1 NM_004046.4  
TTGGCGGCTCGGCCATTTTGTCCCCGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCC
HKR338460 RBb46C12 pGCAP1 NM_004046.4  
TTTTTTGTCCCAGCTCAGTCCGGTAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGATAA
HKR338925 RBb47F05 pGCAP1 NM_004046.4  
NGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR339249 RBb48C01 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR339354 RBb48G10 pGCAP1 NM_004046.4  
TGTTTTTGTCCCAGTCAGTCCGGTAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAAC
HKR339374 RBb48H06 pGCAP1 NM_004046.4  
TGACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGNTCAGTCCGGAGGCTGCGGCTGCAGA
HKR376030 RBd40B06 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR376081 RBd40D09 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR376454 RBd41C06 pGCAP10 NM_004046.4  
TGGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGC
HKR376901 RBd42E05 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR377227 RBd43B03 pGCAP10 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR377283 RBd43D11 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR377321 RBd43F01 pGCAP10 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR378058 RBd45C10 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR378149 RBd45G05 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR378826 RBd47B02 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR379257 RBd48C09 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR379756 RBd49G12 pGCAP10 NM_004046.4  
GAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGT
HKR340010 RBb50A10 pGCAP1 NM_004046.4  
GGGTCCCAGATCAGATCCGGAAGGCCTGCGGCTGCAGAAGTTACCGCCNTGCGGAGTAAC
HKR341254 RBb53C06 pGCAP1 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR341308 RBb53E12 pGCAP1 NM_004046.4  
TGAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGNTAACTGCAAAGATGCTGT
HKR342401 RBb56A01 pGCAP1 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR342575 RBb56H07 pGCAP1 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR343282 RBb58D10 pGCAP1 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR343326 RBb58F06 pGCAP1 NM_004046.4  
GGTCCCAGNTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAA
HKR380074 RBd50D02 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR380102 RBd50E06 pGCAP10 NM_004046.4  
GCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGC
HKR380401 RBd51A01 pGCAP10 NM_004046.4  
TGAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCG
HKR380577 RBd51H09 pGCAP10 NM_004046.4  
AAGAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR380883 RBd52D11 pGCAP10 NM_004046.4  
GGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTG
HKR381249 RBd53C01 pGCAP10 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR381778 RBd54H10 pGCAP10 NM_004046.4  
TGGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR382874 RBd57D02 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR382904 RBd57E08 pGCAP10 NM_004046.4  
GCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTC
HKR382908 RBd57E12 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR382923 RBd57F03 pGCAP10 NM_004046.4  
GGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTA
HKR382926 RBd57F06 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACNNCCTGCGGAGTAACT
HKR383322 RBd58F02 pGCAP10 NM_004046.4  
GAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGT
HKR383729 RBd59F09 pGCAP10 NM_004046.4  
CGGCCGGCCGATGCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCC
HKR344832 RBb62B08 pGCAP1 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAGATG
HKR344876 RBb62D04 pGCAP1 NM_004046.4  
HKR344951 RBb62G07 pGCAP1 NM_004046.4  
HKR345303 RBb63E07 pGCAP1 NM_004046.4  
GAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGT
HKR345602 RBb64A02 pGCAP1 NM_004046.4  
HKR345633 RBb64B09 pGCAP1 NM_004046.4  
TGGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR345724 RBb64F04 pGCAP1 NM_004046.4  
HKR346080 RBb65D08 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR346877 RBb67D05 pGCAP1 NM_004046.4  
AGAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTC
HKR346880 RBb67D08 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR346980 RBb67H12 pGCAP1 NM_004046.4  
HKR347205 RBb68A05 pGCAP1 NM_004046.4  
TGCATTTTGTCCAGTCAGTCCGGAAGGCTGCGGCTTGCAGAAGTACCGCCTGCGGAGTAA
HKR347331 RBb68F11 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR347332 RBb68F12 pGCAP1 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR347769 RBb69H01 pGCAP1 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR384097 RBd60E01 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR384498 RBd61E02 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR384809 RBd62A09 pGCAP10 NM_004046.4  
CGGCCGGCCGATGCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGT
HKR384873 RBd62D01 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR384946 RBd62G02 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR385202 RBd63A02 pGCAP10 NM_004046.4  
GCCCGTTCCTACCGGAAGCTGGGGGAAGTGGCGGCCGGCGGCGGAGGAAGGGCGAGGATG
HKR385226 RBd63B02 pGCAP10 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR385606 RBd64A06 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR385729 RBd64F09 pGCAP10 NM_004046.4  
GACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAG
HKR386497 RBd66E01 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR386810 RBd67A10 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR386849 RBd67C01 pGCAP10 NM_004046.4  
TGCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAAC
HKR386852 RBd67C04 pGCAP10 NM_004046.4  
TGGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAA
HKR386952 RBd67G08 pGCAP10 NM_004046.4  
GGTCCCNGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR387372 RBd68H04 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR387626 RBd69B02 pGCAP10 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR387705 RBd69E09 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR348430 RBb71B06 pGCAP1 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR348498 RBb71E02 pGCAP1 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR388432 RBd71B08 pGCAP10 NM_004046.4  
CGGCCGGCCGATGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAAC
HKR388812 RBd72A12 pGCAP10 NM_004046.4  
GGCACCAAGCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATG
HKR388929 RBd72F09 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR389232 RBd73B08 pGCAP10 NM_004046.4  
GAGTCACTCCGGANGCTGCGGCTGCANAAGTACCGCCTGCGTAGTAACTGCAAAGATGNT
HKR389256 RBd73C08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR390145 RBd75G01 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR390409 RBd76A09 pGCAP10 NM_004046.4  
ATTTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTG
HKR390522 RBd76F02 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR391201 RBd78A01 pGCAP10 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR391276 RBd78D04 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR391282 RBd78D10 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR391284 RBd78D12 pGCAP10 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR391380 RBd78H12 pGCAP10 NM_004046.4  
GNGTCCNGANGCTGCNGCTGCNNAAGTACCGCCTGCGGAGNAACTGCNAAGATGCTGTCC
HKR392036 RBd80B12 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR392056 RBd80C08 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR392079 RBd80D07 pGCAP10 NM_004046.4  
TGGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAA
HKR392407 RBd81A07 pGCAP10 NM_004046.4  
GTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGC
HKR392450 RBd81C02 pGCAP10 NM_004046.4  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGNGGGNGGACGTGGTTGA
HKR392550 RBd81G06 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR392858 RBd82C10 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR392971 RBd82H03 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR393208 RBd83A08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR393324 RBd83F04 pGCAP10 NM_004046.4  
AAGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR393375 RBd83H07 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR393771 RBd84H03 pGCAP10 NM_004046.4  
GATTTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR394003 RBd85A03 pGCAP10 NM_004046.4  
GAGTCNCCCCGGANGCTGCGGATGCAGAACTACCGCCTGCAGANNAACTGCAAAGATGCT
HKR394406 RBd86A06 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR394555 RBd86G11 pGCAP10 NM_004046.4  
GATTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCA
HKR394952 RBd87G08 pGCAP10 NM_004046.4  
TTGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR395302 RBd88E06 pGCAP10 NM_004046.4  
GGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGG
HKR395775 RBd89H07 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR396074 RBd90D02 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR396179 RBd90H11 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR398484 RBd96D12 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR398951 RBd97G07 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR399259 RBd98C11 pGCAP10 NM_004046.4  
AAGCGGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR399281 RBd98D09 pGCAP10 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR399321 RBd98F01 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR399372 RBd98H04 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR399625 RBd99B01 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR402857 RBdS007C09 pGCAP10 NM_004046.4  
AGGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR402859 RBdS007C11 pGCAP10 NM_004046.4  
GAAGCCTCGCTTCGTTGCCACTTCCCAGCTCTTCCCGCCTTCCGCGGTATAATCAACACT
HKR402922 RBdS007F02 pGCAP10 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR402934 RBdS007F14 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR403007 RBdS007I15 pGCAP10 NM_004046.4  
GGCCGGCTGTCTTGACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCT
HKR403061 RBdS007K21 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR403092 RBdS007M04 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR403095 RBdS007M07 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR405231 RBdS013B07 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR405247 RBdS013B23 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR405394 RBdS013I02 pGCAP10 NM_004046.4  
TGAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTC
HKR405488 RBdS013L24 pGCAP10 NM_004046.4  
GAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGT
HKR405492 RBdS013M04 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR405516 RBdS013N04 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR405523 RBdS013N11 pGCAP10 NM_004046.4  
GCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR405566 RBdS013P06 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR405608 RBdS014A08 pGCAP10 NM_004046.4  
TTGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR405666 RBdS014C18 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR405822 RBdS014J06 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR405837 RBdS014J21 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR405930 RBdS014N18 pGCAP10 NM_004046.4  
GGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTG
HKR405945 RBdS014O09 pGCAP10 NM_004046.4  
GCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR406075 RBdS015D03 pGCAP10 NM_004046.4  
GGCTTCGTTGCCACTTCCCAGCTCTTCCCGCCTTCCGCGGTATAATCAACACTACGAGAG
HKR406141 RBdS015F21 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR406210 RBdS015I18 pGCAP10 NM_004046.4  
ATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGC
HKR406352 RBdS015O16 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR408850 RBdS022C02 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR408899 RBdS022E03 pGCAP10 NM_004046.4  
GATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTG
HKR408976 RBdS022H08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR408985 RBdS022H17 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR409068 RBdS022L04 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR409108 RBdS022M20 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR409114 RBdS022N02 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR409124 RBdS022N12 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR416045 RBdS040B21 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR416051 RBdS040C03 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR416163 RBdS040G19 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR416218 RBdS040J02 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR416293 RBdS040M05 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR416310 RBdS040M22 pGCAP10 NM_004046.4  
GCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGC
HKR416329 RBdS040N17 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR420477 RBdS051D05 pGCAP10 NM_004046.4  
GGACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAA
HKR420479 RBdS051D07 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR420592 RBdS051H24 pGCAP10 NM_004046.4  
GCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR420680 RBdS051L16 pGCAP10 NM_004046.4  
ATTTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTG
HKR428030 RBdS070B06 pGCAP10 NM_004046.4  
GAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCG
HKR428207 RBdS070I15 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR428209 RBdS070I17 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR428282 RBdS070L18 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR428303 RBdS070M15 pGCAP10 NM_004046.4  
GCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGC
HKR428374 RBdS070P14 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR430128 RBdS075F08 pGCAP10 NM_004046.4  
GACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAG
HKR430225 RBdS075J09 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR430352 RBdS075O16 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR430364 RBdS075P04 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR432418 RBdS081A18 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR432590 RBdS081H22 pGCAP10 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT
HKR432592 RBdS081H24 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR432677 RBdS081L13 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR433211 RBdS083A11 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR433213 RBdS083A13 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR433245 RBdS083B21 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR433265 RBdS083C17 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR433293 RBdS083D21 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR433300 RBdS083E04 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR433329 RBdS083F09 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR433349 RBdS083G05 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR433378 RBdS083H10 pGCAP10 NM_004046.4  
GCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATG
HKR433406 RBdS083I14 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR433416 RBdS083I24 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR441686 RBdS104D14 pGCAP10 NM_004046.4  
GAGTCNGNCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR441705 RBdS104E09 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR441733 RBdS104F13 pGCAP10 NM_004046.4  
GGNCCNNNTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR441777 RBdS104H09 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR441897 RBdS104M09 pGCAP10 NM_004046.4  
GNNCCNNNTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR441911 RBdS104M23 pGCAP10 NM_004046.4  
TGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGC
HKR441920 RBdS104N08 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR441949 RBdS104O13 pGCAP10 NM_004046.4  
TGAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGC
HKR442087 RBdS105D15 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR442110 RBdS105E14 pGCAP10 NM_004046.4  
TGCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAAC
HKR442121 RBdS105F01 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR442166 RBdS105G22 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR442194 RBdS105I02 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR442231 RBdS105J15 pGCAP10 NM_004046.4  
GAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGT
HKR442279 RBdS105L15 pGCAP10 NM_004046.4  
ATGAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGT
HKR442330 RBdS105N18 pGCAP10 NM_004046.4  
GATTGCAAGCCTCGCTTCGTTGCCACTTCCCAGCTCTTCCCGCCTTCCGCGGTATAATCA
HKR442383 RBdS105P23 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR444029 RBdS110B05 pGCAP10 NM_004046.4  
GGTCCCNNTCNNTCCGGAGGCTGCGGCTGCANAAGTACCGCCTGCGGNGTAACTGCGAAG
HKR444036 RBdS110B12 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR444117 RBdS110E21 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR444153 RBdS110G09 pGCAP10 NM_004046.4  
GAGTCNGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR444370 RBdS110P10 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR452854 RBdS132C06 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR452894 RBdS132D22 pGCAP10 NM_004046.4  
GCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACT
HKR452983 RBdS132H15 pGCAP10 NM_004046.4  
GAGTCCNGNNGCNGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR453025 RBdS132J09 pGCAP10 NM_004046.4  
GCCCNNTCCCTCCGGAGGCTGCGGCTGCCTAAGTACCGCCTGCGGANTAACTGCAAANAT
HKR461680 RBdS154D08 pGCAP10 NM_004046.4  
GATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTG
HKR461682 RBdS154D10 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR461706 RBdS154E10 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR461823 RBdS154J07 pGCAP10 NM_004046.4  
GAGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAA
HKR461893 RBdS154M05 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR461964 RBdS154P04 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR462433 RBdS156B09 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR462525 RBdS156F05 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR462572 RBdS156H04 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR462585 RBdS156H17 pGCAP10 NM_004046.4  
GCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTC
HKR462595 RBdS156I03 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR462597 RBdS156I05 pGCAP10 NM_004046.4  
TGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGC
HKR462600 RBdS156I08 pGCAP10 NM_004046.4  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR462722 RBdS156N10 pGCAP10 NM_004046.4  
TGAGNNNGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGC
HKR462776 RBdS156P16 pGCAP10 NM_004046.4  
GACCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAG
HKR470896 RBdS177D24 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR470989 RBdS177H21 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR471000 RBdS177I08 pGCAP10 NM_004046.4  
GGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG
HKR471059 RBdS177K19 pGCAP10 NM_004046.4  
GCTTCTTTGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTA
HKR471066 RBdS177L02 pGCAP10 NM_004046.4  
GGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCC
HKR471158 RBdS177O22 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR471163 RBdS177P03 pGCAP10 NM_004046.4  
GAGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAA
HKR474823 RBdS187A23 pGCAP10 NM_004046.4  
GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
HKR475056 RBdS187K16 pGCAP10 NM_004046.4  
GCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl