Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110B12

Clone ID RBdS110B12
HP ID HP00364
Gene ID 498
Gene Symbol ATP5A1
Protein Name ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004046.4
Length of RefSeq (bp) 1895
Chromosome 18q21.1
Reference DDBJ accession
UniGene Hs.298280
5'-terminal sequence GAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCT
2011.08.28