Prev. |  KEGG KO K01539 > 

RIKEN DNA Bank Human Resource - ATP1A1

Gene ID NCBI Gene 476 |  KEGG hsa:476
Gene Symbol ATP1A1
Protein Name ATPase Na+/K+ transporting subunit alpha 1
Synonyms CMT2DD|HOMGSMR2
Ortholog resource in our bank

  ATP1A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001698 IRAK004E02 pCMV-SPORT6 BC001330 NM_000701 Partial
HGX039458 IRAK098K18 pCMV-SPORT6 BC050359 NM_000701 Full
HGY082820 IRAL007A20 pOTB7 BC003077 NM_000701 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203207 ARiS008A07 pGCAP10 NM_000701.6  
GGGGCTGGAGCTGCNGCGGGGTCTGGGGCGCAGAGCAGCGGCGGGAGGAGGCGGACACGT
HKR205404 ARiS013I12 pGCAP10 NM_000701.6  
GCCGGGCCTCCNTTCCCCCGGCGGCCCCNGTTCCGGCGGGGGCANCCTCCGGGTNNGGG
HKR442289 RBdS105M01 pGCAP10 NM_000701.6  
GGGAGCTGCGGCGGGGTCTGGGGCGCATAGCATCGGCGGGAGGAGGCGGACACGTGGCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl