Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP1A1

Gene ID (NCBI) 476
Gene Symbol ATP1A1
Protein Name ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01539)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX039458 IRAK098K18 pCMV-SPORT6 BC050359 NM_000701 Full
HGX001698 IRAK004E02 pCMV-SPORT6 BC001330 NM_000701 Partial
HGY082820 IRAL007A20 pOTB7 BC003077 NM_000701 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203207 ARiS008A07 pGCAP10 NM_000701.6  
GGGGCTGGAGCTGCNGCGGGGTCTGGGGCGCAGAGCAGCGGCGGGAGGAGGCGGACACGT
HKR205404 ARiS013I12 pGCAP10 NM_000701.6  
GCCGGGCCTCCNTTCCCCCGGCGGCCCCNGTTCCGGCGGGGGCANCCTCCGGGTNNGGG
HKR442289 RBdS105M01 pGCAP10 NM_000701.6  
GGGAGCTGCGGCGGGGTCTGGGGCGCATAGCATCGGCGGGAGGAGGCGGACACGTGGCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl