Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105M01

Clone ID RBdS105M01
HP ID HP05709
Gene ID 476
Gene Symbol ATP1A1
Protein Name ATPase, Na+/K+ transporting, alpha 1 polypeptide
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000701.6
Length of RefSeq (bp) 3713
Chromosome 1p21
Reference DDBJ accession
UniGene Hs.371889
5'-terminal sequence GGGAGCTGCGGCGGGGTCTGGGGCGCATAGCATCGGCGGGAGGAGGCGGACACGTGGCAA
2011.08.28