Prev. |  KEGG KO K04374 > 

RIKEN DNA Bank Human Resource - ATF4

Gene ID NCBI Gene 468 |  KEGG hsa:468
Gene Symbol ATF4
Protein Name activating transcription factor 4
Synonyms CREB-2|CREB2|TAXREB67|TXREB
Featured content Apoptosis - human
Featured content Mitophagy - human
Ortholog resource in our bank

  ATF4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07012 pCMFlag_hsCREB2 Expression vector of human CREB2

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004812 IRAK012A12 pCMV-SPORT6 BC008090 NM_182810 Full/var
HGX008268 IRAK020L04 pCMV-SPORT6 BC016855 NM_182810 Full
HGX008774 IRAK021P14 pCMV-SPORT6 BC011994 NM_182810 Full/var
HGX017030 IRAK042J14 pCMV-SPORT6 BC024775 NM_182810 Full/var
HGX069724 IRAK174F04 pCMV-SPORT6 BC073990 NM_182810 Full/var
HGY084232 IRAL010J16 pOTB7 BC022088 NM_182810 Full
HGY103544 IRAL058O08 pOTB7 BC073754 NM_182810 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001276 W01A003D04 pENTR-TOPO IRAK012A12 BC008090 NM_182810  
HGE001280 W01A003D08 pENTR-TOPO IRAK012A12 BC008090 NM_182810  
HGE001282 W01A003D10 pENTR-TOPO IRAL010J16 BC022088 NM_182810  
HGE001284 W01A003D12 pENTR-TOPO IRAL010J16 BC022088 NM_182810  
HGE001288 W01A003D16 pENTR-TOPO IRAL010J16 BC022088 NM_182810  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203354 ARiS008G10 pGCAP10 NM_182810.1  
ATTTTCTACTTTGCCCGCCCACAGATGTAGTTTTCTCTGCGCGTGTGCGTTTTCCCTCCT
HKR342098 RBb55E02 pGCAP1 NM_182810.1  
TCCTCCCCGCCCTCAGGGTCCACGGCCACCATGGCGTATTAGGGGCAGCAGTGCCTGCGG
HKR361323 RBd03F03 pGCAP10 NM_182810.1  
TGAGCCATTTCTACTTTGCCCGCCCACAGATGTAGTTTTCTCTGCGCGTGTGCGTTTTCC
HKR396125 RBd90F05 pGCAP10 NM_182810.1  
GAGCCATTTCTACTTTGCCCGCCCACAGATGTAGTTTTCTCTGCGCGTGTGCGTTTTCCC
HKR406071 RBdS015C23 pGCAP10 NM_182810.1  
ATTTCTACTTTGCCCGCCCACAGATGTAGTTTTCTCTGCGCGTGTGCGTTTTCCCTCCTC
HKR432471 RBdS081C23 pGCAP10 NM_182810.1  
GATTTCTACTTTGCCCGCCCACAGATGTAGTTTTCTCTGCGCGTGTGCGTTTTCCCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl