Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081C23

Clone ID RBdS081C23
HP ID HP00208
Gene ID 468
Gene Symbol ATF4
Protein Name activating transcription factor 4 (tax-responsive enhancer element B67)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_182810.1
Length of RefSeq (bp) 1420
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.496487
5'-terminal sequence GATTTCTACTTTGCCCGCCCACAGATGTAGTTTTCTCTGCGCGTGTGCGTTTTCCCTCCT
2011.08.28