Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASS1

Gene ID (NCBI) 445
Gene Symbol ASS1
Protein Name argininosuccinate synthase 1
Synonyms ASS|CTLN1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01940)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084114 IRAL010E18 pOTB7 BC009243 NM_054012 Full
HGY092664 IRAL031K24 pDNR-LIB BC021676 NM_054012 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR323371 RBb08H03 pKA1U5 NM_054012.3  
GGCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCTACNCTATGTCCAGCAAAGGCTCCG
HKR328522 RBb21F02 pKA1U5 NM_054012.3  
GCCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCAGCAAAGGCTCCG
HKR370948 RBd27G04 pGCAP10 NM_054012.3  
GCGGGCCCTGTGCTTATAACCTGGGATGGGCACCCCTGCCAGTCCTGCTCTGCCGCCTGC
HKR370956 RBd27G12 pGCAP10 NM_054012.3  
GAGTCCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCAGCAAAGGCT
HKR371650 RBd29C02 pGCAP10 NM_054012.3  
GGTCCCCGGTCACCGGCCCTGCCCCCGGGCCCTGTGCTTATAACCTGGGATGGGCACCCC
HKR374803 RBd37A03 pGCAP10 NM_054012.3  
GAGTCCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCAGCAAAGGCT
HKR340973 RBb52H05 pGCAP1 NM_054012.3  
GCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCAGCAAAGGCTCCGT
HKR347300 RBb68E04 pGCAP1 NM_054012.3  
GGTCCCCGGTCACCGGCCCTGCCCCCGGGCCCTGTGCTTATAACCTGGGATGGGCACCCC
HKR347325 RBb68F05 pGCAP1 NM_054012.3  
GCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCAGCAAAGGCTCCGT
HKR348059 RBb70C11 pGCAP1 NM_054012.3  
TGCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCAGCAAAGGCTCCG
HKR390127 RBd75F07 pGCAP10 NM_054012.3  
GGCCCTGCCCCCGGGCCCTGTGCTTATAACCTGGGATGGGCACCCCTGCCAGTCCTGCTC
HKR397630 RBd94B06 pGCAP10 NM_054012.3  
GCCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCAGCAAAGGCTCCG
HKR416047 RBdS040B23 pGCAP10 NM_054012.3  
GGGATTCAGGGACGCTGCCGACACCTCGCCTGCTGGAGCGGGCACCGTGTCACCCCCATC
HKR428250 RBdS070K10 pGCAP10 NM_054012.3  
GCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCAGCAAAGGCTCCGT
HKR461848 RBdS154K08 pGCAP10 NM_054012.3  
CGGCCGGCCGATGCCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCA
HKR475086 RBdS187L22 pGCAP10 NM_054012.3  
GGGGCCCTGTGCTTATAACCTGGGATGGGCACCCCTGCCAGTCCTGCTCTGCCGCCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl