Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154K08

Clone ID RBdS154K08
HP ID HP00777
Gene ID 445
Gene Symbol ASS1
Protein Name argininosuccinate synthetase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_054012.3
Length of RefSeq (bp) 1801
Chromosome 9q34.1
Reference DDBJ accession
UniGene Hs.160786
5'-terminal sequence CGGCCGGCCGATGCCTGCTCTGCCGCCTGCCACCGCTGCCCGAGCCCGACGCTATGTCCA
2011.08.28