Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARVCF

Gene ID (NCBI) 421
Gene Symbol ARVCF
Protein Name ARVCF, delta catenin family member
Synonyms -
Databases KEGG hsa:421 |  NCBI Gene 421


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044532 ARe11F12 pKA1U5 NM_001670.1  
GGAGTCCGCCGAGCCTGAGCCCGAGCGGCCGAGGCGCCGGAGCCGAGCCTGGTCCAGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl