Prev. |  Human A to Z list >   >   > 

ARe11F12 - NRCD Human cDNA Clone

Catalog Number HKR044532
Clone Name ARe11F12
Clone info. Plasmid clone of human ARVCF cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGAGTCCGCCGAGCCTGAGCCCGAGCGGCCGAGGCGCCGGAGCCGAGCCTGGTCCAGCCA
Sequence, submitted(2) n.a.
Note match to NM_001670.3 (515-4052) CDS:partial
 
Sequence, refered NM_001670.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(3)  (NCBI Gene 421)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR044532 ARe11F12 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe11F12a.seq   ARe11F12c.seq ARe11F12z.seq ARe11F12.pdf

References and tips

Featured content

Reference


2021.06.04

NRCDhumcloneList_AR_210404.csv - DataSheet_NRCD_html_200831.pl