Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARL3

Gene ID (NCBI) 403
Gene Symbol ARL3
Protein Name ADP-ribosylation factor-like 3
Synonyms ARFL3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07944)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY089558 IRAL023O22 pOTB7 BC008032 NM_004311
HGY090036 IRAL025B12 pOTB7 BC009841 NM_004311 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024510 W01A061E14 pENTR-TOPO IRAL025B12 BC009841 NM_004311  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048571 ARe21H03 pKA1U5 NM_004311.2  
GGAGGAGGGACTCGGCGGGAGGATGGGCTTGCTCTCAATTTTGCGCAAGTTGAAAAGTGC
HKR170483 ARi26D11 pGCAP10 NM_004311.2  
GGTCGGGGGTGGCGCCGCAGCAGTTGCCCCTGGTAACGGGGGAGGCAGCAGGAGGAGGAG
HKR065680 ARe64D08 pKA1U5 NM_004311.2  
GAGCTGTTGCGTGCGAGGGACGTCGGGGGTGGCGCCGCAGCAGTTGCCCCTGGTAACGGG
HKR222323 ARiS055N11 pGCAP10 NM_004311.2  
GGCCCCTGGTAACGGGGGAGGCAGCAGGAGGAGGAGGAGGAGGAGGGACTCGGCGGGAGG
HKR264549 ARiS161G05 pGCAP10 NM_004311.2  
TGAGGAGGAGGAGGAGGAGGGACTCGGCGGGAGGATGGGCTTGCTCTCAATTTTGCGCAA
HKR362009 RBd05A09 pGCAP10 NM_004311.2  
GAGTTGCCCCTGGTAACGGGGGAGGCAGCAGGAGGAGGAGGAGGAGGAGGGACTCGGCGG
HKR380812 RBd52A12 pGCAP10 NM_004311.2  
GGGGGAGGCAGCAGGAGGAGGAGGAGGAGGAGGGACTCGGCGGGAGGATGGGCTTGCTCT
HKR405856 RBdS014K16 pGCAP10 NM_004311.2  
CGGCCGGCCGATTGGGGACTCGGCGGGAGGATGGGCTTGCTCTCAATTTTGCGCAAGTTG
HKR432764 RBdS081P04 pGCAP10 NM_004311.2  
GGCAGTTGCCCCTGGTAACGGGGGAGGCAGCAGGAGGAGGAGGAGGAGGAGGGACTCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl