Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081P04

Clone ID RBdS081P04
HP ID HP00534
Gene ID 403
Gene Symbol ARL3
Protein Name ADP-ribosylation factor-like 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004311.2
Length of RefSeq (bp) 3891
Chromosome 10q23.3
Reference DDBJ accession
UniGene Hs.182215
5'-terminal sequence GGCAGTTGCCCCTGGTAACGGGGGAGGCAGCAGGAGGAGGAGGAGGAGGAGGGACTCGGC
2011.08.28