Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARL2

Gene ID (NCBI) 402
Gene Symbol ARL2
Protein Name ADP-ribosylation factor-like 2
Synonyms ARFL2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07943)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081858 IRAL004K18 pOTB7 BC002530 NM_001667 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004505 W01A011E09 pENTR-TOPO IRAL004K18 BC002530 NM_001667  
HGE004509 W01A011E13 pENTR-TOPO IRAL004K18 BC002530 NM_001667  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051371 ARe28H03 pKA1U5 NM_001667.2  
GGGGAAGAAACGGCGGCCGGGAGGGGGCTCCGGGGACCATGGGGCTCCTGACCATTCTGA
HKR053257 ARe33C09 pKA1U5 NM_001667.2  
GCCGGGACTGGGAAGAAACGGCGGCCGGGAGGGGGCTCCGGGGACCATGGGGCTCCTGAC
HKR058969 ARe47H01 pKA1U5 NM_001667.2  
GACTGGGAAGAAACGGCGGCCGGGAGGGGGCTCCGGGGACCATGGGGCTCCTGACCATTC
HKR184031 ARi60B07 pGCAP10 NM_001667.2  
GGGGACTGGGAAGAAACGGCGGCCGGGAGGGGGCTCCGGGGACCATGGGGCTCCTGACCA
HKR234841 ARiS087B17 pGCAP10 NM_001667.2  
HKR277819 ARiS194J03 pGCAP10 NM_001667.2  
GGGCGGCCGGGAGGGGGCTCCGGGGACCATGGGGCTCCTGACCATTCTGAAGAAGATGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl