Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - ARe47H01

Clone ID ARe47H01
HP ID HP02567
Gene ID 402
Gene Symbol ARL2
Protein Name ADP-ribosylation factor-like 2
Vector pKA1U5
Accession No. in DDBJ
RefSeq NM_001667.2
Length of RefSeq (bp) 978
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.502836
5'-terminal sequence GACTGGGAAGAAACGGCGGCCGGGAGGGGGCTCCGGGGACCATGGGGCTCCTGACCATTC
2011.08.28