Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARHGDIA

Gene ID (NCBI) 396
Gene Symbol ARHGDIA
Protein Name Rho GDP dissociation inhibitor (GDI) alpha
Synonyms GDIA1|HEL-S-47e|NPHS8|RHOGDI|RHOGDI-1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12462)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03494 pAxCALNLhARHGDIA (forward) Shuttle vector to generate rAd harboring human ARHGDIA (forward)
RDB04078 pAxCALNLhARHGDIA (reverse) Shuttle vector to generate rAd harboring human ARHGDIA (reverse)
RDB04693 pAxCALNLhARHGDIA(forward) Shuttle vector to generate rAd expressing human ARHGDIA
RDB05268 pAxCALNLhARHGDIA(forward) Shuttle vector to generate rAd expressing human ARHGDIA
RDB05269 pAxCALNLhARHGDIA(reverse) Shuttle vector to generate rAd expressing human ARHGDIA
RDB05293 pAxCALNLhARHGDIA(forward) Shuttle vector to generate rAd expressing human ARHGDIA
RDB05294 pAxCALNLhARHGDIA(reverse) Shuttle vector to generate rAd expressing human ARHGDIA

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006202 IRAK015I10 pCMV-SPORT6 BC016031 NM_004309 Full
HGY081026 IRAL002J10 pOTB7 BC005851 NM_004309 Full
HGY084365 IRAL010P05 pOTB7 BC005875 NM_004309
HGY085876 IRAL014L12 pOTB7 BC009759 NM_004309 Full
HGY088866 IRAL022C18 pOTB7 BC008701 NM_004309 Full
HGY088912 IRAL022E16 pOTB7 BC024258 NM_004309 Full
HGY093482 IRAL033L18 pOTB7 BC027730 NM_004309 Full
HGY093851 IRAL034K11 pOTB7 BC016185 NM_004309 Full
HGY103394 IRAL058I02 pOTB7 BC075827 NM_004309 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166831 ARi17B07 pGCAP10 NM_004309.3  
GGCGGCCGACGACGTTCGTCATTTAGTGCGGGAGGGATCCTGAACCGCGCGGCCGAACCC
HKR050551 ARe26G07 pKA1U5 NM_004309.3  
GATTTAGTGCGGGAGGGATCCTGAACCGCGCGGCCGAACCCTCCGGTGTCCCGACCCAGG
HKR060028 ARe50B04 pKA1U5 NM_004309.3  
GGCGGCCGAACCCTCCGGTGTTCCCGACCCAGGCTAAGCTTGAGCATGGCTGAGCAGGAG
HKR061212 ARe53A12 pKA1U5 NM_004309.3  
GAGTGCGGGAGGGATCCTGAACCGCGCGGCCGAACCCTCCGGTGTCCCGACCCAGGCTAA
HKR061332 ARe53F12 pKA1U5 NM_004309.3  
GTAGTGCGGGAGGGATCCTGTAACCGCGCGGCCGAACNCTCCGGTGTCCCGACCCAGGCT
HKR062178 ARe55H10 pKA1U5 NM_004309.3  
GAGTGCGGGAGGGATCCTGAACCGCGCGGCCGCCCNTTTNCGGTGTCCCGACCCAGGCTA
HKR064480 ARe61D08 pKA1U5 NM_004309.3  
GGGGGCGGCCGACGACGTTCGTCATTTAGTGCCCGNTGGATCCTGAACCGCGCGGCCGAA
HKR065354 ARe63G10 pKA1U5 NM_004309.3  
GGCGGGAGGGATCCTGAACCGCGCGGCCGAACCCTTNGGTGTCCCGACCCAGGCTAAGCT
HKR235225 ARiS088B01 pGCAP10 NM_004309.3  
GAGTGCGGGAGGGATCCTGAACCGCGCGGCCGAACCCTCCGGNGTCCCGACCCAGGNNAA
HKR382523 RBd56F03 pGCAP10 NM_004309.3  
GGCCGAACCCTCCGGTGTCCCGACCCAGGCTAAGCTTGAGCANGGNNGAGCAGGAGCCCA
HKR388104 RBd70E08 pGCAP10 NM_004309.3  
GGGGCGGGGCGGCCGACGACGTTCGTCATTTAGTGCGGGAGGGATCCTGAACCGCGCGGC
HKR432756 RBdS081O20 pGCAP10 NM_004309.3  
GAGTGCGGNAGGNATCCTGAACCGCGCGGCCGAACCCTCCGTCCCGCCCACAGGTGTCCC
HKR444073 RBdS110D01 pGCAP10 NM_004309.3  
GAGGGATCCTGAACCGCGCGGCCGAACCCTCCGGTGTCCCGACCCAGGCTAAGCTTGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl