Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110D01

Clone ID RBdS110D01
HP ID HP00859
Gene ID 396
Gene Symbol ARHGDIA
Protein Name Rho GDP dissociation inhibitor (GDI) alpha
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004309.3
Length of RefSeq (bp) 1912
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.159161
5'-terminal sequence GAGGGATCCTGAACCGCGCGGCCGAACCCTCCGGTGTCCCGACCCAGGCTAAGCTTGAGC
2011.08.28