Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARG2

Gene ID (NCBI) 384
Gene Symbol ARG2
Protein Name arginase 2
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01476)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX020009 IRAK050A09 pCMV-SPORT6 BC029050 NM_001172 Full
HGY080748 IRAL001O12 pOTB7 BC001350 NM_001172 Full
HGY088658 IRAL021K18 pDNR-LIB BC008464 NM_001172 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363732 RBd09F12 pGCAP10 NM_001172.3  
TAGAGCAGCGGCGGGCGGTGGCGCTCACTCCCGGCTTCCAACCGCGCGGAGCCTCTGCCT
HKR452903 RBdS132E07 pGCAP10 NM_001172.3  
GGGACGCTGGCGCGGGTAGGTAAGAGCAGCGGCGGGCGGTGGCGCTCACTCCCGGCTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl