Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132E07

Clone ID RBdS132E07
HP ID HP04045
Gene ID 384
Gene Symbol ARG2
Protein Name arginase, type II
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001172.3
Length of RefSeq (bp) 1981
Chromosome 14q24.1-q24.3
Reference DDBJ accession
UniGene Hs.708024
5'-terminal sequence GGGACGCTGGCGCGGGTAGGTAAGAGCAGCGGCGGGCGGTGGCGCTCACTCCCGGCTTCC
2011.08.28