Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARF3

Gene ID (NCBI) 377
Gene Symbol ARF3
Protein Name ADP-ribosylation factor 3
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07938)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15341 pcDNA3/hArf3(WT)-HA Expression vector of human ARF3, wild type.
RDB15344 pEGFP-N3/hArf3-EGFP Expression vector of human ARF3, wild type.
RDB15346 pcDNA3/hArf3-mCherry Expression vector of human ARF3, wild type.

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY018545 IRAK046G01 pBluescriptR BC028402 NM_001659 Full
HGY081365 IRAL003G21 pOTB7 BC017565 NM_001659 Full
HGY086992 IRAL017H24 pOTB7 BC007762 NM_001659 Full
HGY089449 IRAL023K09 pOTB7 BC007647 NM_001659 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055603 ARe39A03 pKA1U5 NM_001659.2  
GCCGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGTAGTGGGCCAGGGCAGCANCC
HKR178849 ARi47C01 pGCAP10 NM_001659.2  
GACAGCTCCAGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCC
HKR072407 ARe81A07 pKA1U5 NM_001659.2  
GGGGAAGGAAGGAGGGAGCCGGGGAGTGGGCCNCNGCANCANCCGGGCTGAAGTCGGCTT
HKR074127 ARe85F07 pKA1U5 NM_001659.2  
GATCCCGGGCTGGGGGTGGGGGTACGCCGCACAGCTCCAGTCGCCGTCGCGGCTTCCGGT
HKR235427 ARiS088J11 pGCAP10 NM_001659.2  
GGCGGCTTCCGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGAGTGGGCCAGGGCA
HKR328427 RBb21B03 pKA1U5 NM_001659.2  
GGCGGCTTCCGGTGCTAGGTGGAGGGAAGGAANGAGGGAGCCGGGGAGTGGGCCAGGGCA
HKR382972 RBd57H04 pGCAP10 NM_001659.2  
GAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGAGTGGGCCAGNNNNNCAGCCGGGCTGAAG
HKR394825 RBd87B01 pGCAP10 NM_001659.2  
GGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGAGTGGGCCAGGGCAGCAGCCGGG
HKR420413 RBdS051A13 pGCAP10 NM_001659.2  
TGAGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.10.27

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_171016.pl