Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051A13

Clone ID RBdS051A13
HP ID HP05153
Gene ID 377
Gene Symbol ARF3
Protein Name ADP-ribosylation factor 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001659.2
Length of RefSeq (bp) 3556
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.119177
5'-terminal sequence TGAGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGAGT
2011.08.28