Prev. |  KEGG KO K04524 > 

RIKEN DNA Bank Human Resource - APOE

Gene ID NCBI Gene 348 |  KEGG hsa:348
Gene Symbol APOE
Protein Name apolipoprotein E
Synonyms AD2|APO-E|ApoE4|LDLCQ5|LPG
Featured content Alzheimer disease - human
Ortholog resource in our bank

  APOE

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07556 pGL4-phAPOE Promoter collection, Human APOE promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082591 IRAL006H23 pOTB7 BC003557 NM_000041 Full
HGY103422 IRAL058J06 pOTB7 BC072022

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037384 W01A093H16 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE037392 W01A093H24 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE037418 W01A093J02 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE037422 W01A093J06 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE037428 W01A093J12 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE037432 W01A093J16 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE046449 W01A116C01 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE046451 W01A116C03 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE046453 W01A116C05 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE046455 W01A116C07 pENTR-TOPO IRAL006H23 BC003557 NM_000041  
HGE046459 W01A116C11 pENTR-TOPO IRAL006H23 BC003557 NM_000041  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178457 ARi46C09 pGCAP10 NM_000041.2  
GCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
HKR331772 RBb29H04 pGCAP1 NM_000041.2  
GCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.11.09

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl