Prev. |  KEGG KO K01623 > 

RIKEN DNA Bank Human Resource - ALDOC

Gene ID NCBI Gene 230 |  KEGG hsa:230
Gene Symbol ALDOC
Protein Name aldolase, fructose-bisphosphate C
Synonyms ALDC
Ortholog resource in our bank

  ALDOC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056282 IRAK140L18 pCMV-SPORT6 BC065565 NM_005165 Full
HGY081523 IRAL003N11 pOTB7 BC003613 NM_005165 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082101 ARf05E05 pKA1U5 NM_005165.2  
GAGCTCTGCGACATCCGCAGCCTCATTTACCAGAGGGAGCCAGGGCTGCAGCCTCATCTG
HKR186079 ARi65D07 pGCAP10 NM_005165.2  
TTGATTTTACCAGAGGGAGCCAGGGCTGCAGCCTCATCTGTTTGCGGATCAGAACCCGAG
HKR405787 RBdS014H19 pGCAP10 NM_005165.2  
GAGAGGGAGCCAGGGCTGCAGCCTCATCTGTTTGCGGATCAGAACCCGAGCTGTGCTTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl