Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ALDOC

Gene ID (NCBI) 230
Gene Symbol ALDOC
Protein Name aldolase C, fructose-bisphosphate
Synonyms ALDC
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01623)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056282 IRAK140L18 pCMV-SPORT6 BC065565 NM_005165 Full
HGY081523 IRAL003N11 pOTB7 BC003613 NM_005165 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082101 ARf05E05 pKA1U5 NM_005165.2  
GAGCTCTGCGACATCCGCAGCCTCATTTACCAGAGGGAGCCAGGGCTGCAGCCTCATCTG
HKR186079 ARi65D07 pGCAP10 NM_005165.2  
TTGATTTTACCAGAGGGAGCCAGGGCTGCAGCCTCATCTGTTTGCGGATCAGAACCCGAG
HKR405787 RBdS014H19 pGCAP10 NM_005165.2  
GAGAGGGAGCCAGGGCTGCAGCCTCATCTGTTTGCGGATCAGAACCCGAGCTGTGCTTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl