Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014H19

Clone ID RBdS014H19
HP ID HP05753
Gene ID 230
Gene Symbol ALDOC
Protein Name aldolase C, fructose-bisphosphate
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005165.2
Length of RefSeq (bp) 1665
Chromosome 17cen-q12
Reference DDBJ accession
UniGene Hs.155247
5'-terminal sequence GAGAGGGAGCCAGGGCTGCAGCCTCATCTGTTTGCGGATCAGAACCCGAGCTGTGCTTGT
2011.08.28