Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ALDOA

Gene ID (NCBI) 226
Gene Symbol ALDOA
Protein Name aldolase A, fructose-bisphosphate
Synonyms ALDA|GSD12|HEL-S-87p
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07512 pGL4-phALDOA Promoter collection, Human ALDOA promoter

RDB_hum_161122.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005412 IRAK013I20 pCMV-SPORT6 BC010660 NM_184043 Full
HGX006206 IRAK015I14 pCMV-SPORT6 BC015888 NM_184043 Full
HGX007877 IRAK019L13 pCMV-SPORT6 BC012880 NM_184043 Full
HGX008731 IRAK021N19 pCMV-SPORT6 BC013614 NM_184043 Full
HGY080408 IRAL001A08 pOTB7 BC000367 NM_184043 Partial
HGY085456 IRAL013K16 pOTB7 BC004333 NM_184043 Full
HGY089414 IRAL023I22 pOTB7 BC016170 NM_184043 Partial
HGY093115 IRAL032N03 pDNR-LIB BC016800 NM_184043 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040404 ARe01A04 pKA1U5 NM_000034.2  
GACACTCCGTCCACGGACTCTCCGTTATTTTAGGAGGTCCCTGGCCAAAGATTTATTTCT
HKR041633 ARe04B09 pKA1U5 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCC
HKR043255 ARe08C07 pKA1U5 NM_000034.2  
ATCCTGGCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGA
HKR081307 ARf03E11 pKA1U5 NM_000034.2  
GGCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCG
HKR082531 ARf06F11 pKA1U5 NM_000034.2  
GCTCTCGGAACGCGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGNTTCTCTCCTTGAA
HKR082859 ARf07C11 pKA1U5 NM_000034.2  
TTGNNANAAGGGGTNCTGGTGGACGANTNCCGCGTTCTCTCCTTGAATNCANCTCNCCCA
HKR162034 ARi05B10 pGCAP10 NM_000034.2  
GGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGC
HKR162107 ARi05E11 pGCAP10 NM_000034.2  
CGGCCGGCCGATGGAGTACCGGGTACGCAGGGGTGCCTCAACCACACTCCGTCCACGGAC
HKR162834 ARi07B10 pGCAP10 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR044531 ARe11F11 pKA1U5 NM_000034.2  
GGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCNTAGAAGGGGTCCTGGTGACGAGTC
HKR046498 ARe16E02 pKA1U5 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCC
HKR046825 ARe17B01 pKA1U5 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCC
HKR046883 ARe17D11 pKA1U5 NM_000034.2  
GGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGC
HKR047677 ARe19D05 pKA1U5 NM_000034.2  
GAGAAGGGGTCCTGGTGACGAGTCCCGCGATTCTCTNNTTGAATCCACTCGCCAGCCCGC
HKR165236 ARi13B12 pGCAP10 NM_000034.2  
TGAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCGCCGC
HKR166153 ARi15G09 pGCAP10 NM_000034.2  
TGCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGC
HKR048170 ARe20H02 pKA1U5 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR050897 ARe27E01 pKA1U5 NM_000034.2  
TGGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGCAGAAGGGGTCCTGGTGACGA
HKR051629 ARe29B05 pKA1U5 NM_000034.2  
GGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGCTTCTCTCCTTGAATCCACTCGCCAG
HKR170922 ARi27F02 pGCAP10 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR171256 ARi28C08 pGCAP10 NM_000034.2  
GGAATCCACTCGCCAGCCCGCCGCCCTCTGCCGCCGCACCCTGCACACCCGCCCCTCTCC
HKR052576 ARe31H08 pKA1U5 NM_000034.2  
GGCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCG
HKR054577 ARe36H09 pKA1U5 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR172074 ARi30D02 pGCAP10 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCC
HKR172105 ARi30E09 pGCAP10 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGC
HKR174579 ARi36H11 pGCAP10 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR056174 ARe40H06 pKA1U5 NM_000034.2  
TGGGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTTCTCTCCTTGAATCCACTCGCC
HKR176955 ARi42G11 pGCAP10 NM_000034.2  
GCCTCACCCCTTTCCTTCCCACAGGTCCCTGGCCAAAGATTTATTTCTCTTGACAACCAA
HKR060455 ARe51C07 pKA1U5 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCC
HKR062458 ARe56C10 pKA1U5 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAANNCNGCATGCGTTCCTCTCGGAACGCG
HKR063203 ARe58A03 pKA1U5 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR064403 ARe61A03 pKA1U5 NM_000034.2  
GGCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATNNGCTGCGTTCCTCTCGGAACGCG
HKR064484 ARe61D12 pKA1U5 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAANCGNCTGCGTTTCCTCTCGGAACGCGC
HKR066876 ARe67D04 pKA1U5 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCC
HKR067605 ARe69A05 pKA1U5 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR067747 ARe69G03 pKA1U5 NM_000034.2  
GAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCGCC
HKR184856 ARi62C08 pGCAP10 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR185281 ARi63D09 pGCAP10 NM_000034.2  
TTGTTCNACCGGNTCCTGGTGACNAGNNNNGCNNCTCNNNTGNACCGNGTTCNCTGCCAG
HKR185729 ARi64F09 pGCAP10 NM_000034.2  
HKR186081 ARi65D09 pGCAP10 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGC
HKR186150 ARi65G06 pGCAP10 NM_000034.2  
GGCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCG
HKR068435 ARe71B11 pKA1U5 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGC
HKR188027 ARi70B03 pGCAP10 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR072003 ARe80A03 pKA1U5 NM_000034.2  
GGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGC
HKR072809 ARe82A09 pKA1U5 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR074172 ARe85H04 pKA1U5 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGC
HKR074802 ARe87A02 pKA1U5 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCC
HKR075610 ARe89A10 pKA1U5 NM_000034.2  
GACACTCCGTCCACGGACTCTCCGTTATTTTAGGAGGTCCCTGGCCAAAGATTTATTTCT
HKR077369 ARe93H01 pKA1U5 NM_000034.2  
TTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGCAGAAGG
HKR079697 ARe99E01 pKA1U5 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGC
HKR205347 ARiS013G03 pGCAP10 NM_000034.2  
GGCCCGCCTCCTGCNCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCG
HKR205529 ARiS013N17 pGCAP10 NM_000034.2  
GGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGCAGAAGGGGTCCTGGTGACGAG
HKR208285 ARiS020L21 pGCAP10 NM_000034.2  
GAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCGCC
HKR209205 ARiS023A05 pGCAP10 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGC
HKR209498 ARiS023M10 pGCAP10 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR218055 ARiS045C07 pGCAP10 NM_000034.2  
NGGCCGCNNANGGGGTCCTGNNNACGAGTCCCNCGTTCTCTCCTNGAATCCACTCGCCAG
HKR218354 ARiS045O18 pGCAP10 NM_000034.2  
AGAAGTGTTATAGGANGAGTCTGGCCCTTGAGTACCGGGTACGCAGGGGTGCCTCAACCAC
HKR234151 ARiS085G07 pGCAP10 NM_000034.2  
GGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGC
HKR234329 ARiS085N17 pGCAP10 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGC
HKR235008 ARiS087I16 pGCAP10 NM_000034.2  
GCCTTGAGTACCGGGTACGCAGGGGTGCCTCAACCACACTCCGTCCACGGACTCTCCGTT
HKR235421 ARiS088J05 pGCAP10 NM_000034.2  
GACACACTCCGTCCACGGACTCTCCGTTATTTTAGGAGGTCCCTGGCCAAAGATTTATTT
HKR243628 ARiS109B04 pGCAP10 NM_000034.2  
GGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGC
HKR248824 ARiS122A24 pGCAP10 NM_000034.2  
GCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCC
HKR260198 ARiS150I06 pGCAP10 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR279554 ARiS198O18 pGCAP10 NM_000034.2  
GCCGCCTCCNGCGCCGCCCCTTCCGNGGCTNNNTCGGCTGCGTTCCTCTCGGAACGCGCC
HKR320810 RBb02A10 pKA1U5 NM_000034.2  
TGGCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGC
HKR322411 RBb06A11 pKA1U5 NM_000034.2  
GATTTCCAAGGAAGAATTTCCTCTGAAGCACCGGAACTTGCTACTACCAGCACCATGCCC
HKR323225 RBb08B01 pKA1U5 NM_000034.2  
GGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCTCCGNTCTGGATTTCCAAGGAAGAA
HKR324177 RBb10H09 pKA1U5 NM_000034.2  
TGCCCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCG
HKR364808 RBd12A08 pGCAP10 NM_000034.2  
GGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCG
HKR365330 RBd13F10 pGCAP10 NM_000034.2  
GCCTTGCANTTATTTNNCTTGAGGACANGGGCCTCCTGANTTATTTTTCTCCAAGANNTT
HKR368904 RBd22E08 pGCAP10 NM_000034.2  
GACGTGATCCGAGTCCCTCACCCCTTTCCTTCCCACAGGTCCCTGGCCAAAGATTTATTT
HKR333323 RBb33F03 pGCAP1 NM_000034.2  
AGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCGCCG
HKR376103 RBd40E07 pGCAP10 NM_000034.2  
CCGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCG
HKR340532 RBb51F12 pGCAP1 NM_000034.2  
GCCCGCCTCCTGCGCCGCCCCTTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCG
HKR348956 RBb72G12 pGCAP1 NM_000034.2  
TGGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAG
HKR396807 RBd92A07 pGCAP10 NM_000034.2  
TTGGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCC
HKR397330 RBd93F10 pGCAP10 NM_000034.2  
GAGATCGGGGACACATGTGGGGCGGGCAGGAGCTGCCTTATAACCAGCCCGGGAACCCCT
HKR405506 RBdS013M18 pGCAP10 NM_000034.2  
GGTTATTTTAGGAGGTCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCTCCGT
HKR430240 RBdS075J24 pGCAP10 NM_000034.2  
GGCCTCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGC
HKR453107 RBdS132M19 pGCAP10 NM_000034.2  
GGAACGCGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTC
HKR471178 RBdS177P18 pGCAP10 NM_000034.2  
GGCGTTCCTCTCGGAACGCGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCC
HKR475122 RBdS187N10 pGCAP10 NM_000034.2  
GCCCTTTCCTTCCCACAGGTCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl