Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187N10

Clone ID RBdS187N10
HP ID HP00064
Gene ID 226
Gene Symbol ALDOA
Protein Name aldolase A, fructose-bisphosphate
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000034.2
Length of RefSeq (bp) 2353
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.513490
5'-terminal sequence GCCCTTTCCTTCCCACAGGTCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCT
2011.08.28