Prev. |  KEGG KO K06547 > 

RIKEN DNA Bank Human Resource - ALCAM

Gene ID NCBI Gene 214 |  KEGG hsa:214
Gene Symbol ALCAM
Protein Name activated leukocyte cell adhesion molecule
Synonyms CD166|MEMD
Ortholog resource in our bank

  ALCAM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053487 IRAK133L23 pBluescript BC057809 NM_001627 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062122 ARe55F02 pKA1U5 NM_001627.2  
GAGAGCAGCCCGGAGACCGCTGCCGCCGCTGCCNCNTGNTACCACCGCTGCCACCTGAGG
HKR066123 ARe65F03 pKA1U5 NM_001627.2  
GAGAGCAGCCCGGAGACCGCTGCCGCCGCTGCCGCTGCTACCACCGCTGCCACCTGAGGA
HKR219619 ARiS049A19 pGCAP10 NM_001627.2 done
GAGAGCAGCCCGGANACCGCTGCCGCCGCTGCCGCTGCTACCACCGCTGCCACCTGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl