Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ALCAM

Gene ID (NCBI) 214
Gene Symbol ALCAM
Protein Name activated leukocyte cell adhesion molecule
Synonyms CD166|MEMD
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY053487 IRAK133L23 pBluescript BC057809 NM_001627 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062122 ARe55F02 pKA1U5 NM_001627.2  
GAGAGCAGCCCGGAGACCGCTGCCGCCGCTGCCNCNTGNTACCACCGCTGCCACCTGAGG
HKR066123 ARe65F03 pKA1U5 NM_001627.2  
GAGAGCAGCCCGGAGACCGCTGCCGCCGCTGCCGCTGCTACCACCGCTGCCACCTGAGGA
HKR219619 ARiS049A19 pGCAP10 NM_001627.2 done
GAGAGCAGCCCGGANACCGCTGCCGCCGCTGCCGCTGCTACCACCGCTGCCACCTGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.13

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl