Prev. |  Human A to Z list >  A >  ALCAM > 

ARiS049A19 - NRCD Human cDNA Clone

Catalog Number HKR219619
Clone Name ARiS049A19
Clone info. Plasmid clone of human ALCAM cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GAGAGCAGCCCGGANACCGCTGCCGCCGCTGCCGCTGCTACCACCGCTGCCACCTGAGGA
Sequence, submitted(2) n.a.
 
Sequence, refered NM_001627.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ALCAM (NCBI Gene 214)  other clone of ALCAM in our bank
Synonyms CD166|MEMD
Protein Name activated leukocyte cell adhesion molecule
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR219619 ARiS049A19 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARiS049A19a.seq   ARiS049A19c.seq   ARiS049A19.pdf

References and tips

Featured content

Reference


2021.08.05

NRCDhumcloneList_AR_210404.csv - GNP_filter3_NRCD_html_190131.pl