Prev. |  KEGG KO K01939 > 

RIKEN DNA Bank Human Resource - ADSS

Gene ID NCBI Gene 159 |  KEGG hsa:159
Gene Symbol ADSS
Protein Name adenylosuccinate synthase
Synonyms ADEH|ADSS 2
Ortholog resources KEGG ortholog (KEGG orthology K01939) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091830 IRAL029J14 pOTB7 BC012356 NM_001126 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR329629 RBb24B05 pGCAP1 NM_001126.2  
GGCAGAGCAGTTCAGTTCGCTCACTCCTCGCCGGCCGCCTCTCCTTCGGGCTCTCCTCGC
HKR396906 RBd92E10 pGCAP10 NM_001126.2  
GGCCGGCCTCTGGCTCCTTCTTCCTCTGCATGTGGCTGGCGGCCGCAGAGCAGTTCAGTT
HKR475146 RBdS187O10 pGCAP10 NM_001126.2  
GGCAGAGCAGTTCAGTTCGCTCACTCCTCGCCGGCCGCCTCTCCTTCGGGCTCTCCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl