Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187O10

Clone ID RBdS187O10
HP ID HP01480
Gene ID 159
Gene Symbol ADSS
Protein Name adenylosuccinate synthase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001126.2
Length of RefSeq (bp) 2775
Chromosome 1cen-q12
Reference DDBJ accession
UniGene Hs.498313
5'-terminal sequence GGCAGAGCAGTTCAGTTCGCTCACTCCTCGCCGGCCGCCTCTCCTTCGGGCTCTCCTCGC
2011.08.28