Prev. |  KEGG KO K10798 > 

RIKEN DNA Bank Human Resource - PARP1

Gene ID NCBI Gene 142 |  KEGG hsa:142
Gene Symbol PARP1
Protein Name poly(ADP-ribose) polymerase 1
Synonyms ADPRT|ADPRT 1|ADPRT1|ARTD1|PARP|PARP-1|PARS|PPOL|Poly-PARP|pADPRT-1
Featured content DNA repair (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  PARP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07725 pGL4-phPARP1(ADPRT) Promoter collection, Human PARPI promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025767 IRAK064G23 pCMV-SPORT6 BC037545 NM_001618 Full/var
HGY092313 IRAL030N01 pOTB7 BC014206 NM_001618

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE043478 W01A108L14 pENTR-TOPO IRAK064G23 BC037545 NM_001618 done
HGE043484 W01A108L20 pENTR-TOPO IRAK064G23 BC037545 NM_001618  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064003 ARe60A03 pKA1U5 NM_001618.3  
ATCCTGGAGGCGCCTGCGGCTGGGTGAGCGCACGCGAGGCGGCGAGGCGGCAGCGTGTTT
HKR162170 ARi05H02 pGCAP10 NM_001618.3  
GGCCTGCGGCTGGGTGAGCGCACGCGAGGCGGCGAGGCGGCAGCGTGTTTCTAGGTCGTG
HKR336850 RBb42C02 pGCAP1 NM_001618.3  
GGGTGGCGGCTCTGGCCGCTCAGGCGCCTGCGGCTGGGTGAGCGCACGCGAGGCGGCGAG
HKR385231 RBd63B07 pGCAP10 NM_001618.3  
GGGTGGCGGCTCTGGCCGCTCAGGCGCCTGCGGCTGGGTGAGCGCACGCGAGGCGGCGAG
HKR453065 RBdS132L01 pGCAP10 NM_001618.3  
GATCAGGGAACGGCGGTGGCCGGTGCGGCGTGTTCGGTGGCGGCTCTGGCCGCTCAGGCG
HKR475143 RBdS187O07 pGCAP10 NM_001618.3  
GAGGCGCCTGCGGCTGGGTGAGCGCACGCGAGGCGGCGAGGCGGCAGCGTGTTTCTAGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.11.09

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl