Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132L01

Clone ID RBdS132L01
HP ID HP05602
Gene ID 142
Gene Symbol PARP1
Protein Name poly (ADP-ribose) polymerase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001618.3
Length of RefSeq (bp) 4001
Chromosome 1q41-q42
Reference DDBJ accession
UniGene Hs.177766
5'-terminal sequence GATCAGGGAACGGCGGTGGCCGGTGCGGCGTGTTCGGTGGCGGCTCTGGCCGCTCAGGCG
2011.08.28