Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ADH5

Gene ID (NCBI) 128
Gene Symbol ADH5
Protein Name alcohol dehydrogenase 5 (class III), chi polypeptide
Synonyms ADH-3|ADHX|FALDH|FDH|GSH-FDH|GSNOR
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00121)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX069845 IRAK174K05 pCMV-SPORT6 BC070491 NM_000671 Full
HGY093660 IRAL034C12 pOTB7 BC014665 NM_000671 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082475 ARf06D03 pKA1U5 NM_000671.3  
AGGATGTCAGCCCCCCGCGCCGACCAGAATCCGTGAACATGGCGAACGAGGTTATCAAGT
HKR044011 ARe10A11 pKA1U5 NM_000671.3  
GAGCCCCCCGCGCCGACCAGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGC
HKR058882 ARe47D10 pKA1U5 NM_000671.3  
GTGAGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGCTGCAGTTGCTTGGGA
HKR177773 ARi44H05 pGCAP10 NM_000671.3  
GAGCCCCCCGCGCCGACCAGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGC
HKR179332 ARi48F12 pGCAP10 NM_000671.3  
GCCCCCGCGCCGACCAGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGCTGC
HKR279284 ARiS198D12 pGCAP10 NM_000671.3  
TAGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGCTGCAGTTGCTTGGGAGG
HKR322032 RBb05B08 pKA1U5 NM_000671.3  
GAGCCCCCCGCGCCGACCAGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGC
HKR416059 RBdS040C11 pGCAP10 NM_000671.3  
GAGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGCTGCAGTTGCTTGGGAGG
HKR420573 RBdS051H05 pGCAP10 NM_000671.3  
TCCCCGGATGTCAGCCCCCCGCGCCGACCAGAATCCGTGAACATGGCGAACGAGGTTATC
HKR428248 RBdS070K08 pGCAP10 NM_000671.3  
AGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGCTGCAGTTGCTTGGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl