Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070K08

Clone ID RBdS070K08
HP ID HP00972
Gene ID 128
Gene Symbol ADH5
Protein Name alcohol dehydrogenase 5 (class III), chi polypeptide
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000671.3
Length of RefSeq (bp) 2644
Chromosome 4q21-q25
Reference DDBJ accession
UniGene Hs.78989
5'-terminal sequence AGAATCCGTGAACATGGCGAACGAGGTTATCAAGTGCAAGGCTGCAGTTGCTTGGGAGGC
2011.08.28