Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACTN4

Gene ID (NCBI) 81
Gene Symbol ACTN4
Protein Name actinin, alpha 4
Synonyms ACTININ-4|FSGS|FSGS1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05699)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04614 SEREX clone NGO-Br-15 (ID 855) #1 SEREX clone NGO-Br-15 (ID 855) #1

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087459 IRAL018K19 pOTB7 BC005033 NM_004924 Full
HGY093539 IRAL033O03 pOTB7 BC015620 NM_004924 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046922 ARe17F02 pKA1U5 NM_004924.3  
GAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGA
HKR166548 ARi16G04 pGCAP10 NM_004924.3  
GGCAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCG
HKR167730 ARi19F10 pGCAP10 NM_004924.3  
GGGAGGGCGGGCTGAAGCAGCTGAAGCGGCGGTAGCGGCGGCGGCTCGGGCAGAGGGGCG
HKR057372 ARe43H04 pKA1U5 NM_004924.3  
GAGAGGGGCGGGAGCTGAGGCGGGAGCGGACANCCTTTGTGGGCGAGCGAGAGGCGGCGG
HKR183774 ARi59H06 pGCAP10 NM_004924.3  
GGGCAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGC
HKR069658 ARe74C10 pKA1U5 NM_004924.3  
GAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGA
HKR234915 ARiS087E19 pGCAP10 NM_004924.3  
GGNCNGCNCGGNCNGNGGANCGNNNGCNNNNNNGGNANCGGACNGGCNGNNGNGCGANCG
HKR234994 ARiS087I02 pGCAP10 NM_004924.3  
GGGCGGCTCGGGCAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCG
HKR264560 ARiS161G16 pGCAP10 NM_004924.3  
GAGAGGGNNNNNAGCTGNNNCNNNNGCNGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGA
HKR392524 RBd81F04 pGCAP10 NM_004924.3  
GAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGA
HKR405978 RBdS014P18 pGCAP10 NM_004924.3  
AGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl