Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014P18

Clone ID RBdS014P18
HP ID HP04891
Gene ID 81
Gene Symbol ACTN4
Protein Name actinin, alpha 4
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004924.3
Length of RefSeq (bp) 3893
Chromosome 19q13
Reference DDBJ accession
UniGene Hs.270291
5'-terminal sequence AGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGAA
2011.08.28